Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 4212986
End position: 4213009
Length: 24

DNA sequence
>NC_008345, from 4212986 to 4213009 (24 bp); Shewanella frigidimarina NCIMB 400 ATTATGGTTATGGTTATGGTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4213006-4213284	Sequence	Sfri_3544 - hypothetical protein (Protein is coded in complementary strand; from 4213284 to 4213006)