Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 4442028
End position: 4442051
Length: 24

DNA sequence
>NC_008345, from 4442028 to 4442051 (24 bp); Shewanella frigidimarina NCIMB 400 GGGTTGAGGTTGGGGTTGGGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4441984-4442946	Sequence	Sfri_3737 - rod shape-determining protein MreC (Protein is coded in complementary strand; from 4442946 to 4441984)