Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 701561
End position: 701585
Length: 25

DNA sequence
>NC_008345, from 701561 to 701585 (25 bp); Shewanella frigidimarina NCIMB 400 AATTAAGTTAAATTCAATCAAATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 701022-701654	Sequence	Sfri_0602 - transcriptional regulator, LuxR family protein (Protein is coded in complementary strand; from 701654 to 701022)