Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 3596340
End position: 3596366
Length: 27

DNA sequence
>NC_008345, from 3596340 to 3596366 (27 bp); Shewanella frigidimarina NCIMB 400 ACGATGATGACGATGATGACGACGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3595767-3597611	Sequence	Sfri_2996 - RNA polymerase sigma-70 subunit RpoD