Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 4048154
End position: 4048180
Length: 27

DNA sequence
>NC_008345, from 4048154 to 4048180 (27 bp); Shewanella frigidimarina NCIMB 400 AAAGCGATAAAAGCGGTAAAAGCGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4047278-4048156	Sequence	Sfri_3398 - transcriptional regulator, LysR family protein