Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 4244958
End position: 4244984
Length: 27

DNA sequence
>NC_008345, from 4244958 to 4244984 (27 bp); Shewanella frigidimarina NCIMB 400 TAGTCTGACTAGTTTGACTAGTTTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4244714-4244995	Sequence	Sfri_3574 - hypothetical protein (Protein is coded in complementary strand; from 4244995 to 4244714)