Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 710611
End position: 710637
Length: 27

DNA sequence
>NC_008345, from 710611 to 710637 (27 bp); Shewanella frigidimarina NCIMB 400 AACGCCAACAACGCCGACCACGCCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 710427-712487	Sequence	Sfri_0609 - twin-arginine translocation pathway signal