Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 2548270
End position: 2548297
Length: 28

DNA sequence
>NC_008345, from 2548270 to 2548297 (28 bp); Shewanella frigidimarina NCIMB 400 ATTACTCATCACTCATTACCCATTACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2548293-2548586	Sequence	Sfri_2141 - hypothetical protein (Protein is coded in complementary strand; from 2548586 to 2548293)