Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 4088532
End position: 4088559
Length: 28

DNA sequence
>NC_008345, from 4088532 to 4088559 (28 bp); Shewanella frigidimarina NCIMB 400 CTTTTTACTTTTTACTTTTTACTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4088544-4089152	Sequence	Sfri_3436 - glutathione-dependent formaldehyde-activating protein (Protein is coded in complementary strand; from 4089152 to 4088544)