Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 3028111
End position: 3028140
Length: 30

DNA sequence
>NC_008345, from 3028111 to 3028140 (30 bp); Shewanella frigidimarina NCIMB 400 TTGCTAATGCTAATGCTAATGCTAATGCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3027274-3029349	Sequence	Sfri_2532 - transglutaminase domain-containing protein