Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 1444092
End position: 1444127
Length: 36

DNA sequence
>NC_008345, from 1444092 to 1444127 (36 bp); Shewanella frigidimarina NCIMB 400 CTTTTTCCACAATCTTTTCCACAACTTTTTCGACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1439246-1447108	Sequence	Sfri_1221 - beta-ketoacyl synthase (Protein is coded in complementary strand; from 1447108 to 1439246)