Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 2148865
End position: 2148900
Length: 36

DNA sequence
>NC_008345, from 2148865 to 2148900 (36 bp); Shewanella frigidimarina NCIMB 400 AAATCTGAATTCAAATCTGAGTTCAAATCTGAGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2148238-2149419	Sequence	Sfri_1821 - carbohydrate kinase (Protein is coded in complementary strand; from 2149419 to 2148238)