Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 3636155
End position: 3636190
Length: 36

DNA sequence
>NC_008345, from 3636155 to 3636190 (36 bp); Shewanella frigidimarina NCIMB 400 TTCTTATCGTTCTTATCGCTCTTATCGCTCTTATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3635693-3636304	Sequence	Sfri_3029 - hypothetical protein (Protein is coded in complementary strand; from 3636304 to 3635693)