Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 3693942
End position: 3693977
Length: 36

DNA sequence
>NC_008345, from 3693942 to 3693977 (36 bp); Shewanella frigidimarina NCIMB 400 ATCATCATCAAAATCTTCGTCAAAGTCATCATCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3693910-3695076	Sequence	Sfri_3087 obgE GTPase ObgE (Protein is coded in complementary strand; from 3695076 to 3693910)