Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 3786308
End position: 3786343
Length: 36

DNA sequence
>NC_008345, from 3786308 to 3786343 (36 bp); Shewanella frigidimarina NCIMB 400 GTTATGCTAAAAGTTATGCTAAAAGTTATGCTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3786334-3787002	Sequence	Sfri_3162 folE GTP cyclohydrolase I (Protein is coded in complementary strand; from 3787002 to 3786334)