Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 3998627
End position: 3998662
Length: 36

DNA sequence
>NC_008345, from 3998627 to 3998662 (36 bp); Shewanella frigidimarina NCIMB 400 AGCTAATTCAGCAGCTAATTTAGCTTCTAATTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3998364-3998816	Sequence	Sfri_3348 rplI 50S ribosomal protein L9 (Protein is coded in complementary strand; from 3998816 to 3998364)