Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 4264773
End position: 4264808
Length: 36

DNA sequence
>NC_008345, from 4264773 to 4264808 (36 bp); Shewanella frigidimarina NCIMB 400 ACGATTCACAAAACGATTCACAAAATGATTCACTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4264528-4264947	Sequence	Sfri_3588 - hypothetical protein (Protein is coded in complementary strand; from 4264947 to 4264528)