Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 4339974
End position: 4340009
Length: 36

DNA sequence
>NC_008345, from 4339974 to 4340009 (36 bp); Shewanella frigidimarina NCIMB 400 CCGCCCATTCCGCCCATTCCACCCATTCCGCCCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4339965-4341602	Sequence	Sfri_3660 groEL chaperonin GroEL (Protein is coded in complementary strand; from 4341602 to 4339965)