Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 2114470
End position: 2114508
Length: 39

DNA sequence
>NC_008345, from 2114470 to 2114508 (39 bp); Shewanella frigidimarina NCIMB 400 TTTTAATATTAGTTTTGGATATTAGTTTTTGATAATAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2112221-2114476	Sequence	Sfri_1792 - PAS/PAC sensor-containing diguanylate cyclase/phosphodiesterase