Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 3559810
End position: 3559848
Length: 39

DNA sequence
>NC_008345, from 3559810 to 3559848 (39 bp); Shewanella frigidimarina NCIMB 400 ATCATTGTCAAAAATCATCGCCAAAAATCATTGCCAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3558128-3559885	Sequence	Sfri_2960 - binding-protein-dependent transport systems inner membrane component