Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 1329675
End position: 1329719
Length: 45

DNA sequence
>NC_008345, from 1329675 to 1329719 (45 bp); Shewanella frigidimarina NCIMB 400 TTTCTCTTGAAGGCTTTTCTCTTGACTGTTTGTCTCTTGAAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1329668-1331203	Sequence	Sfri_1130 - hypothetical protein (Protein is coded in complementary strand; from 1331203 to 1329668)