Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 1892939
End position: 1892983
Length: 45

DNA sequence
>NC_008345, from 1892939 to 1892983 (45 bp); Shewanella frigidimarina NCIMB 400 ACTACCTGCAATAGCATTACTTGCAATAGTATTACCCGCAATAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1892784-1893386	Sequence	Sfri_1588 - hypothetical protein (Protein is coded in complementary strand; from 1893386 to 1892784)