Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 2520981
End position: 2521025
Length: 45

DNA sequence
>NC_008345, from 2520981 to 2521025 (45 bp); Shewanella frigidimarina NCIMB 400 CCTGTGTAATCAAATCCTTTGCCATCAAATCCTTTGTCATCAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2520186-2521028	Sequence	Sfri_2118 - short chain dehydrogenase (Protein is coded in complementary strand; from 2521028 to 2520186)