Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 2943469
End position: 2943513
Length: 45

DNA sequence
>NC_008345, from 2943469 to 2943513 (45 bp); Shewanella frigidimarina NCIMB 400 GACTTATTTGAAATAGCCTGATTTGACATAGCCTGGTTTGAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2942800-2944476	Sequence	Sfri_2470 - formate/nitrite transporter (Protein is coded in complementary strand; from 2944476 to 2942800)