Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 4003380
End position: 4003424
Length: 45

DNA sequence
>NC_008345, from 4003380 to 4003424 (45 bp); Shewanella frigidimarina NCIMB 400 TTAGGCTTATCAGACTTTGGTTTGTCAGACTTAGGTTTATCAGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4003227-4005716	Sequence	Sfri_3355 - ribonuclease R (Protein is coded in complementary strand; from 4005716 to 4003227)