Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 4434158
End position: 4434202
Length: 45

DNA sequence
>NC_008345, from 4434158 to 4434202 (45 bp); Shewanella frigidimarina NCIMB 400 CAGTGTTATTTCAACCAGTATTATTTCAACCAGTGTTATTTCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4434194-4435024	Sequence	Sfri_3732 - nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (Protein is coded in complementary strand; from 4435024 to 4434194)