Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 3740533
End position: 3740580
Length: 48

DNA sequence
>NC_008345, from 3740533 to 3740580 (48 bp); Shewanella frigidimarina NCIMB 400 CTTGTCTATTAACGATACTGTCTATTAACGATACTGCCTATTAACGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3740574-3741233	Sequence	Sfri_3126 - cytoplasmic chaperone TorD family protein (Protein is coded in complementary strand; from 3741233 to 3740574)