Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 4435253
End position: 4435306
Length: 54

DNA sequence
>NC_008345, from 4435253 to 4435306 (54 bp); Shewanella frigidimarina NCIMB 400 GTTAGCTTTAGTTTCTACGTTAGCTTTAGTATCTACGTTAGCTTTAGTATCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4434948-4439279	Sequence	Sfri_3733 - hypothetical protein (Protein is coded in complementary strand; from 4439279 to 4434948)