Sequence retrieval

Genome: Oenococcus oeni PSU-1
Start position: 1134956
End position: 1134979
Length: 24

DNA sequence
>NC_008528, from 1134956 to 1134979 (24 bp); Oenococcus oeni PSU-1 AGTCGAAGTAGAAGTAGAAGTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1134783-1135955	Sequence	OEOE_1199 - LysM repeat-containing muramidase (Protein is coded in complementary strand; from 1135955 to 1134783)