Sequence retrieval

Genome: Oenococcus oeni PSU-1
Start position: 1331964
End position: 1331993
Length: 30

DNA sequence
>NC_008528, from 1331964 to 1331993 (30 bp); Oenococcus oeni PSU-1 CTTCAGCTTCGGCTTCAGCTTCGGCTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1331876-1332466	Sequence	OEOE_1419 - 50S ribosomal protein L11 (Protein is coded in complementary strand; from 1332466 to 1331876)