Sequence retrieval

Genome: Oenococcus oeni PSU-1
Start position: 1405636
End position: 1405665
Length: 30

DNA sequence
>NC_008528, from 1405636 to 1405665 (30 bp); Oenococcus oeni PSU-1 AAATTCAAGAAAACTCAAAAAAATAAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1405651-1406292	Sequence	OEOE_1488 - ABC-type cobalt transport system, permease component CbiQ or related transporter (Protein is coded in complementary strand; from 1406292 to 1405651)