Sequence retrieval

Genome: Oenococcus oeni PSU-1
Start position: 1415817
End position: 1415841
Length: 25

DNA sequence
>NC_008528, from 1415817 to 1415841 (25 bp); Oenococcus oeni PSU-1 TTTTTTTTATTATTTTTTTCTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1415546-1416598	Sequence	OEOE_1499 - glycosyltransferase-like protein (Protein is coded in complementary strand; from 1416598 to 1415546)