Sequence retrieval

Genome: Oenococcus oeni PSU-1
Start position: 1660364
End position: 1660393
Length: 30

DNA sequence
>NC_008528, from 1660364 to 1660393 (30 bp); Oenococcus oeni PSU-1 TCTAATCCCTTCTAATCCCTTCTAATCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1660393-1661760	Sequence	OEOE_1739 - hypothetical protein (Protein is coded in complementary strand; from 1661760 to 1660393)