Sequence retrieval

Genome: Oenococcus oeni PSU-1
Start position: 684886
End position: 684912
Length: 27

DNA sequence
>NC_008528, from 684886 to 684912 (27 bp); Oenococcus oeni PSU-1 TAAAAGTTGAAAAAGTTGTAAAAGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 684765-685124	Sequence	OEOE_0731 - camphor resistance protein CrcB (Protein is coded in complementary strand; from 685124 to 684765)