Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 1908668
End position: 1908691
Length: 24

DNA sequence
>NC_008563, from 1908668 to 1908691 (24 bp); Escherichia coli APEC O1 CGGGATCGGCATCGGCATCGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1907943-1909499	Sequence	APECO1_873 yoaE hypothetical protein (Protein is coded in complementary strand; from 1909499 to 1907943)