Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 3853030
End position: 3853053
Length: 24

DNA sequence
>NC_008563, from 3853030 to 3853053 (24 bp); Escherichia coli APEC O1 TATTTTTGTATTTTTGTATTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3853030-3853368	Sequence	APECO1_3035 aufF Auf fimbrial chaperone AufF (Protein is coded in complementary strand; from 3853368 to 3853030)