Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 4280714
End position: 4280737
Length: 24

DNA sequence
>NC_008563, from 4280714 to 4280737 (24 bp); Escherichia coli APEC O1 GGTGCAGGTGCAGGTGCAGGTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4280675-4281868	Sequence	APECO1_2675 hemX uroporphyrinogen III C-methyltransferase (Protein is coded in complementary strand; from 4281868 to 4280675)