Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 4409174
End position: 4409197
Length: 24

DNA sequence
>NC_008563, from 4409174 to 4409197 (24 bp); Escherichia coli APEC O1 AATGCCAATGGCGATGCCAATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4408467-4409501	Sequence	APECO1_2561 rhaT rhamnose-proton symporter (Protein is coded in complementary strand; from 4409501 to 4408467)