Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 4661872
End position: 4661895
Length: 24

DNA sequence
>NC_008563, from 4661872 to 4661895 (24 bp); Escherichia coli APEC O1 ATGCAAATGAAACTGCAAATGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4661651-4662085	Sequence	APECO1_2357 phnO aminoalkylphosphonic acid N-acetyltransferase (Protein is coded in complementary strand; from 4662085 to 4661651)