Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 556576
End position: 556599
Length: 24

DNA sequence
>NC_008563, from 556576 to 556599 (24 bp); Escherichia coli APEC O1 ATATCAATACCAATATCCATTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 556297-557532	Sequence	APECO1_1499 allC allantoate amidohydrolase (Protein is coded in complementary strand; from 557532 to 556297)