Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 3599560
End position: 3599586
Length: 27

DNA sequence
>NC_008563, from 3599560 to 3599586 (27 bp); Escherichia coli APEC O1 TGCACGACCAGCACGACCTGCACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3598706-3600646	Sequence	APECO1_3268 deaD ATP-dependent RNA helicase DeaD (Protein is coded in complementary strand; from 3600646 to 3598706)