Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 466398
End position: 466424
Length: 27

DNA sequence
>NC_008563, from 466398 to 466424 (27 bp); Escherichia coli APEC O1 TCCATGCCTTCCATACCTTCCATACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 466371-467327	Sequence	APECO1_1579 cyoA cytochrome o ubiquinol oxidase subunit II (Protein is coded in complementary strand; from 467327 to 466371)