Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 4735665
End position: 4735691
Length: 27

DNA sequence
>NC_008563, from 4735665 to 4735691 (27 bp); Escherichia coli APEC O1 TTCGCTACCTTCGCTACCTTCGCTACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4734342-4735868	Sequence	APECO1_2291 eutE ethanolamine utilization protein EutE (Protein is coded in complementary strand; from 4735868 to 4734342)