Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 3768784
End position: 3768813
Length: 30

DNA sequence
>NC_008563, from 3768784 to 3768813 (30 bp); Escherichia coli APEC O1 GTCGTGGTCGTGATCGTGGTGGTGATCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3768689-3769279	Sequence	APECO1_3105 slyD FKBP-type peptidyl-prolyl cis-trans isomerase (Protein is coded in complementary strand; from 3769279 to 3768689)