Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 2081964
End position: 2081999
Length: 36

DNA sequence
>NC_008563, from 2081964 to 2081999 (36 bp); Escherichia coli APEC O1 TTCTTGATCTGTATCTTTATCTGTATCTTTATCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2081365-2082441	Sequence	APECO1_1040 - hypothetical protein (Protein is coded in complementary strand; from 2082441 to 2081365)