Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 3324748
End position: 3324783
Length: 36

DNA sequence
>NC_008563, from 3324748 to 3324783 (36 bp); Escherichia coli APEC O1 AGCAAACACAGCAAACACAGCAAACACAGCAAACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3324732-3325037	Sequence	APECO1_3517 papI fimbrial regulatory protein (Protein is coded in complementary strand; from 3325037 to 3324732)