Sequence retrieval

Genome: Escherichia coli APEC O1
Start position: 2948444
End position: 2948488
Length: 45

DNA sequence
>NC_008563, from 2948444 to 2948488 (45 bp); Escherichia coli APEC O1 ATTTTGACGGGGCAGATTTTGATGCGTCAGATTTTGACGGGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2947858-2948799	Sequence	APECO1_3876 - hypothetical protein (Protein is coded in complementary strand; from 2948799 to 2947858)