Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 12855
End position: 12884
Length: 30

DNA sequence
>NC_008570, from 12855 to 12884 (30 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 CGCTGCTCGCCGCTGCTGACCCCGGCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 12555-13238	Sequence	AHA_0013 - KDP operon transcriptional regulatory protein KdpE (Protein is coded in complementary strand; from 13238 to 12555)