Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 1312899
End position: 1312922
Length: 24

DNA sequence
>NC_008570, from 1312899 to 1312922 (24 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 CTTGGCCTGGGCCTGGGCCTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1312096-1314141	Sequence	AHA_1206 - M13 family peptidase (Protein is coded in complementary strand; from 1314141 to 1312096)