Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 1448465
End position: 1448488
Length: 24

DNA sequence
>NC_008570, from 1448465 to 1448488 (24 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 GCCGCCGCCGACGGCGCCGCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1448163-1449728	Sequence	AHA_1333 eutE acetaldehyde dehydrogenase (Protein is coded in complementary strand; from 1449728 to 1448163)